#TiRNA: a coarse-grained method with temperature and ion effects for RNA structure folding and prediction
TiRNA is a coarse-grained computational method developed by Tan-group at Wuhan University for RNA structure modeling. The model incorporates the effects of temperature and ions to provide predictions for 3D structures and thermal stability of RNAs in monovalent/divalent ion solutions.
###Key Features:
- (1) Three-bead coarse-grained representation (P, C4', and N1/N9);
- (2) Force field accounting for temperature and ion effects;
- (3) Replica-exchange Monte Carlo & Monte Carlo simulated annealing for structure sampling;
###Package Modules:
- (1) RNA 3D Structure Prediction: Predicting 3D structures from sequences or secondary structures at given ion conditions;
- (2) RNA Thermal Stability Prediction: Predicting structures at various temperatures which can be used for analyzing melting temperatures and thermally unfolding pathways.
- Operating System: Linux;
- CPU: ≥8 cores with 2 threads;
- Compiler: GCC ≥7.5 (supporting C++11 standard);
- Python: Version ≥3.11.5;
- Python Packages: Biopython ≥1.80 (pip install biopython).
1.Download the TiRNA package
2.Verify dependencies
- gcc --version # Should be ≥7.5;
- python --version # Should be ≥3.11.5;
- python -c "import Bio; print(f'Biopython version: {Bio.version}')" #≥1.70 .
1.Prediction for RNA 3D Structure and Thermal Stability from Sequences
Location: Run in from-sequence/
Steps:
(1) Prepare sequence file (seq.dat)
- Input your RNA sequence in seq.dat
- Example:
- GGCGAUGUCCAGCAGAUACACGUCGUUCGCACC
(2) Configure parameters (config.dat)
- Sampling_type 1
- Folding_steps 750000
- Optimizing_steps 500000
- C_Na 1000
- C_Mg 0
- N_cout 10
(3) Run the simulation with TiRNA
- bash run.sh
2.RNA 3D Structure Prediction with Given Secondary Structure
- Location: Run in from-2D-structure/
Steps:
(1) Prepare sequence and secondary structure (seq.dat)
- Format: sequence followed by secondary structure in dot-bracket notation
- Example:
- GGAGGAAGGAGCCUCC
- (((((......)))))
(2) Configure parameters (config.dat) - same as those in from-sequence
(3) Run the simulation with TiRNA
- bash run.sh
3.RNA 3D Structure Prediction from Initial Structures
3A. From Initial Structure in PDB Format
- Location: Run in from-3D-structure/PDB
- Steps:
- (1) Place your initial PDB structure file in the directory;
- (2) Configure parameters in config.dat;
- (3) Run with bash run.sh.
3B. From 3D Structure in CIF Format
- Location: Run in from-3D-structure/CIF
- Steps:
- (1) Place your initial CIF structure file in the directory;
- (2) Configure parameters in config.dat;
- (3) Run with bash run.sh.
| Parameter | Description |
|---|---|
Sampling_type |
1 for replica-exchange Monte Carlo (REMC),0 for Monte Carlo simulated annealing(MCSA) |
Folding_steps |
Number of steps for structure folding |
Optimizing_steps |
Number of steps for structure optimization |
C_Na |
Na⁺ concentration in mM |
C_Mg |
Mg²⁺ concentration in mM |
N_cout |
Number of output predicted 3D structures |
- Folding_steps: ≥500,000 steps recommended;
- Optimizing_steps: ≥100,000 steps recommended.
- Folding_steps: ≥2,000,000 steps recommended;
- Optimizing_steps: ≥100,000 steps recommended.
- For more accurate 3D structure prediction:
- REMC: Use ≥750,000 folding steps and ≥500,000 optimizing steps;
- MCSA: Use ≥3,000,000 folding steps and ≥500,000 optimizing steps.
- For more accurate thermal stability prediction:
- REMC: Use ≥4,000,000 folding steps;
- MCSA: Use ≥20,000,000 folding steps.
After successful execution, results are saved in the results/ directory:
| Directory | Content Description |
|---|---|
Folding_trajectory/ |
Folding trajectories at different temperatures |
CG_structures/ |
Predicted top-N 3D CG structures |
Secondary_structure/ |
Predicted top-N secondary structures in dot-bracket notation |
All_atom_structure/ |
All-atom structures corresponding to top-N CG structures |
Thermal_Stability/ |
Data for thermal stability analysis |
- Place all input files in the data directory before running the program.
- Only seq.dat is accepted as the input sequence file.
- The program will overwrite the result output folder on each run. To preserve previous results:
- Rename the existing result folder, or
- Move it to another location before execution.
To refine the predicted all-atom structures and remove potential steric clashes or chain breaks, use QRNAS:
- Install QRNAS from: https://github.com/sunandan-mukherjee/QRNAS.git
For questions or issues regarding TiRNA, please contact: zjtan@whu.edu.cn.
- [1] Wang X, Lou E, Yu S, Tan YL, Shi YZ, & Tan ZJ. 2025. TiRNA: a coarse-grained method with temperature and ion effects for RNA structure folding and prediction. In preparation.
- [2] Wang X, Tan YL, Yu S, Shi YZ, & Tan ZJ. 2023. Predicting 3D structures and stabilities for complex RNA pseudoknots in ion solutions. Biophys J. 122, 1503-1516.
- [3] Shi YZ, Wang FH, Wu YY, & Tan ZJ. 2014. A coarse-grained model with implicit salt for RNAs: Predicting 3D structure, stability and salt effect. J Chem Phys. 141, 105102.
- [4] Stasiewicz J, Mukherjee S, Nithin C, & Bujnicki JM. 2019. QRNAS: Software tool for refinement of nucleic acid structures. BMC Struct Biol. 19, 5.
TiRNA Package - Tan Group, Wuhan University