Example .ini file for countess_cmd

[hannahle]

The docs (https://github.com/CountESS-Project/CountESS) here says that to run countess in headless mode, we type:

countess_cmd your_config.ini

Is there an example your_config.ini that you can provide?

For example, I attached the BRCA_example.json from the previous example of Enrich2 (python2) here.

How do I turn this json into a properly formatted .INI file?

{
    "conditions": [
      {
        "name": "E3", 
        "selections": [
          {
            "libraries": [
              {
                "barcodes": {
                  "map file": "Data/BRCA1_example_barcodemap.txt.bz2"
                }, 
                "fastq": {
                  "filters": {
                    "min quality": 20
                  }, 
                  "length": 16, 
                  "reads": "Data/BRCA1_input_sample.fq.bz2", 
                  "reverse": 0
                }, 
                "name": "E3 Input", 
                "report filtered reads": false, 
                "timepoint": 0, 
                "variants": {
                  "min count": 0, 
                  "use aligner": false, 
                  "wild type": {
                    "coding": true, 
                    "reference offset": 0, 
                    "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATC"
                  }
                }
              }, 
              {
                "barcodes": {
                  "map file": "Data/BRCA1_example_barcodemap.txt.bz2"
                }, 
                "fastq": {
                  "filters": {
                    "min quality": 20
                  }, 
                  "length": 16, 
                  "reads": "Data/BRCA1_rep1_rd2.fq.bz2", 
                  "reverse": 0
                }, 
                "name": "Rep1 Rd2", 
                "report filtered reads": false, 
                "timepoint": 2, 
                "variants": {
                  "min count": 0, 
                  "use aligner": false, 
                  "wild type": {
                    "coding": true, 
                    "reference offset": 0, 
                    "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATC"
                  }
                }
              }, 
              {
                "barcodes": {
                  "map file": "Data/BRCA1_example_barcodemap.txt.bz2"
                }, 
                "fastq": {
                  "filters": {
                    "min quality": 20
                  }, 
                  "length": 16, 
                  "reads": "Data/BRCA1_rep1_rd5.fq.bz2", 
                  "reverse": 0
                }, 
                "name": "Rep1 Rd5", 
                "report filtered reads": false, 
                "timepoint": 5, 
                "variants": {
                  "min count": 0, 
                  "use aligner": false, 
                  "wild type": {
                    "coding": true, 
                    "reference offset": 0, 
                    "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATC"
                  }
                }
              }
            ], 
            "name": "Rep1"
          }, 
          {
            "libraries": [
              {
                "barcodes": {
                  "map file": "Data/BRCA1_example_barcodemap.txt.bz2"
                }, 
                "fastq": {
                  "filters": {
                    "min quality": 20
                  }, 
                  "length": 16, 
                  "reads": "Data/BRCA1_input_sample.fq.bz2", 
                  "reverse": 0
                }, 
                "name": "E3 Input", 
                "report filtered reads": false, 
                "timepoint": 0, 
                "variants": {
                  "min count": 0, 
                  "use aligner": false, 
                  "wild type": {
                    "coding": true, 
                    "reference offset": 0, 
                    "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATC"
                  }
                }
              }, 
              {
                "barcodes": {
                  "map file": "Data/BRCA1_example_barcodemap.txt.bz2"
                }, 
                "fastq": {
                  "filters": {
                    "min quality": 20
                  }, 
                  "length": 16, 
                  "reads": "Data/BRCA1_rep2_rd2.fq.bz2", 
                  "reverse": 0
                }, 
                "name": "Rep2 Rd2", 
                "report filtered reads": false, 
                "timepoint": 2, 
                "variants": {
                  "min count": 0, 
                  "use aligner": false, 
                  "wild type": {
                    "coding": true, 
                    "reference offset": 0, 
                    "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATC"
                  }
                }
              }, 
              {
                "barcodes": {
                  "map file": "Data/BRCA1_example_barcodemap.txt.bz2"
                }, 
                "fastq": {
                  "filters": {
                    "min quality": 20
                  }, 
                  "length": 16, 
                  "reads": "Data/BRCA1_rep2_rd5.fq.bz2", 
                  "reverse": 0
                }, 
                "name": "Rep2 Rd5", 
                "report filtered reads": false, 
                "timepoint": 5, 
                "variants": {
                  "min count": 0, 
                  "use aligner": false, 
                  "wild type": {
                    "coding": true, 
                    "reference offset": 0, 
                    "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATC"
                  }
                }
              }
            ], 
            "name": "Rep2"
          }
        ]
      }
    ], 
    "name": "BRCA1 Example", 
    "output directory": "Results/"
  }

[nickzoic]

G'day Hannah!

Part of the idea with CountESS is that you can create programs graphically, by combining plugins, and these programs are then saved and loaded as INI files. So in your case you'd be combining a FastQ reader plugin with a variant caller plugin.

The command line program can load this same INI file format which is handy if you want to develop the programs on a small dataset and then run them on a larger dataset. The INI file format is about as user friendly as JSON, more or less, so you could write it by hand, but it probably isn't the easiest way. An Enrich JSON format to CountESS INI format translation tool might be possible though!

The big problem though is that the variant calling isn't implemented yet ... I'll add that as a separate issue, and we can leave this issue as documentation and examples for the INI file format ...

[nickzoic]

I'm adding a whole "Getting Started" document and countess-demo repo which should address this.