ntHash is an efficient rolling hash function for k-mers and spaced seeds.
Make sure Meson is installed on the system.
Download the repo (either from the releases section or close using git clone https://github.com/BirolLab/ntHash). Setup meson in an arbitrary directory (e.g. build), by running the following command in the project's root (include --prefix=PREFIX set the installation prefix to PREFIX):
meson setup --buildtype=release --prefix=PREFIX buildThen, install the project and its dependencies using:
meson install -C build This will install include/nthash and lib/libnthash.a to the installation prefix.
To use ntHash in a C++ project:
- Import ntHash in the code using
#include <nthash/nthash.hpp> - Access ntHash classes from the
nthashnamespace - Add the
includedirectory (pass-IPREFIX/includeto the compiler) - Link the code with
libnthash.a(i.e. pass-LPREFIX/lib -lnthashto the compiler, wherePREFIXis the installation prefix) - Compile your code with
-std=c++17(and preferably-O3) enabled
Refer to docs for more information.
Generally, the nthash::NtHash and nthash::SeedNtHash classes are used for hashing sequences:
nthash::NtHash nth("TGACTGATCGAGTCGTACTAG", 1, 5); // 1 hash per 5-mer
while (nth.roll()) {
// use nth.hashes() for canonical hashes
// nth.get_forward_hash() for forward strand hashes
// nth.get_reverse_hash() for reverse strand hashes
}std::vector<std::string> seeds = {"10101", "11011"};
nthash::SeedNtHash nth("TGACTGATCGAGTCGTACTAG", seeds, 3, 5);
while (nth.roll()) {
// nth.hashes()[0] = "T#A#T"'s first hash
// nth.hashes()[1] = "T#A#T"'s second hash
// nth.hashes()[2] = "T#A#T"'s third hash
// nth.hashes()[3] = "TG#CT"'s first hash
}If you would like to contribute to the development of ntHash, after forking/cloning the repo, create the build directory without the release flag:
meson setup build
Compile the code, tests, and benchmarking script using:
meson compile -C build
If compilation is successful, libnthash.a will be available in the build folder. The benchmarking script is also compiled as the bench binary file in build.
Before sending a PR, make sure that:
- tests pass by running
meson testin the project directory - code is formatted properly by running
ninja clang-formatin thebuildfolder (requiresclang-formatto be available) - coding standards have been met by making sure running
ninja clang-tidy-checkinbuildreturns no errors (requiresclang-toolsto be installed) - documentation is up-to-date by running
ninja docsinbuild(requires doxygen)
Parham Kazemi, Johnathan Wong, Vladimir Nikolić, Hamid Mohamadi, René L Warren, Inanç Birol, ntHash2: recursive spaced seed hashing for nucleotide sequences, Bioinformatics, 2022;, btac564, https://doi.org/10.1093/bioinformatics/btac564
Hamid Mohamadi, Justin Chu, Benjamin P Vandervalk, and Inanc Birol. ntHash: recursive nucleotide hashing. Bioinformatics (2016) 32 (22): 3492-3494. doi:10.1093/bioinformatics/btw397
